Review



pampkα cst  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Cell Signaling Technology Inc pampkα cst
    Pampkα Cst, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 46053 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pampk%CE%B1+cst/Akt+Antibody/pm39747658-190-69-70
    Average 99 stars, based on 46053 article reviews
    pampkα cst - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: TRIM32 regulates insulin sensitivity by controlling insulin receptor degradation in the liver.
    Article Snippet: .. Reagents and tools table Reagent/Resource Reference or Source Identifier or Catalog Number Experimental models C57BL/6J (M. musculus) IISER Mohali, Chandigarh, India NA HepG2 ATCC HB-8065 293T ATCC CRL-11268 Recombinant DNA pEGFP-N1_hTRIM32 Addgene 69541 Reagent/Resource Reference or Source Identifier or Catalog Number HA-UBIQUITIN WT Addgene 17608 pcDNA3.1-2xFLAGSREBP-1c Addgene 26802 GFP-hIR Addgene 24049 pLKO.1 TRIM32 shRNA plasmid Merck TRCN0000040829 Antibodies pAKT S473 CST 4058S pAKT T308 CST 4056 tAKT CST 9272s pAMPKα CST 2535s tAMPKα CST 2535 pACC CST 3661 t-ACC CST 3676 GAPDH CST D16h11(5174) α-tubulin CST 2144 Phospho-IGF-I Receptor β (Tyr1135/1136)/ Insulin Receptor β (Tyr1150/1151) CST 3024 INSR CST 3020s GFP Novus NB600-308 FASn ABclonal A0461 TRIM32 ABclonal A7079 Lamin A/C CST 4777s Mouse-Anti-flag Sigma F1804 SREBP1-c Novus NB100-2215 Na/K+ ATPase CST 3010S Oligonucleotides and other sequence-based reagents Primer ID Sequence mMARCHF7 F. P M. musculus TCTTGGAGGCATAGTCAAGTTC mMARCHF7 R. P M. musculus GACTCTCTTCTCCTGTCCAAATC mHUWE1F.P M. musculus CACTGTCCTCCTCTCTCTATGT © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on January 7, 2025 from IP 2400:1a00:b030:5c8c:1ec:4998:fda6:5e7. ..

    shRNA:

    Article Title: TRIM32 regulates insulin sensitivity by controlling insulin receptor degradation in the liver.
    Article Snippet: .. Reagents and tools table Reagent/Resource Reference or Source Identifier or Catalog Number Experimental models C57BL/6J (M. musculus) IISER Mohali, Chandigarh, India NA HepG2 ATCC HB-8065 293T ATCC CRL-11268 Recombinant DNA pEGFP-N1_hTRIM32 Addgene 69541 Reagent/Resource Reference or Source Identifier or Catalog Number HA-UBIQUITIN WT Addgene 17608 pcDNA3.1-2xFLAGSREBP-1c Addgene 26802 GFP-hIR Addgene 24049 pLKO.1 TRIM32 shRNA plasmid Merck TRCN0000040829 Antibodies pAKT S473 CST 4058S pAKT T308 CST 4056 tAKT CST 9272s pAMPKα CST 2535s tAMPKα CST 2535 pACC CST 3661 t-ACC CST 3676 GAPDH CST D16h11(5174) α-tubulin CST 2144 Phospho-IGF-I Receptor β (Tyr1135/1136)/ Insulin Receptor β (Tyr1150/1151) CST 3024 INSR CST 3020s GFP Novus NB600-308 FASn ABclonal A0461 TRIM32 ABclonal A7079 Lamin A/C CST 4777s Mouse-Anti-flag Sigma F1804 SREBP1-c Novus NB100-2215 Na/K+ ATPase CST 3010S Oligonucleotides and other sequence-based reagents Primer ID Sequence mMARCHF7 F. P M. musculus TCTTGGAGGCATAGTCAAGTTC mMARCHF7 R. P M. musculus GACTCTCTTCTCCTGTCCAAATC mHUWE1F.P M. musculus CACTGTCCTCCTCTCTCTATGT © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on January 7, 2025 from IP 2400:1a00:b030:5c8c:1ec:4998:fda6:5e7. ..

    Plasmid Preparation:

    Article Title: TRIM32 regulates insulin sensitivity by controlling insulin receptor degradation in the liver.
    Article Snippet: .. Reagents and tools table Reagent/Resource Reference or Source Identifier or Catalog Number Experimental models C57BL/6J (M. musculus) IISER Mohali, Chandigarh, India NA HepG2 ATCC HB-8065 293T ATCC CRL-11268 Recombinant DNA pEGFP-N1_hTRIM32 Addgene 69541 Reagent/Resource Reference or Source Identifier or Catalog Number HA-UBIQUITIN WT Addgene 17608 pcDNA3.1-2xFLAGSREBP-1c Addgene 26802 GFP-hIR Addgene 24049 pLKO.1 TRIM32 shRNA plasmid Merck TRCN0000040829 Antibodies pAKT S473 CST 4058S pAKT T308 CST 4056 tAKT CST 9272s pAMPKα CST 2535s tAMPKα CST 2535 pACC CST 3661 t-ACC CST 3676 GAPDH CST D16h11(5174) α-tubulin CST 2144 Phospho-IGF-I Receptor β (Tyr1135/1136)/ Insulin Receptor β (Tyr1150/1151) CST 3024 INSR CST 3020s GFP Novus NB600-308 FASn ABclonal A0461 TRIM32 ABclonal A7079 Lamin A/C CST 4777s Mouse-Anti-flag Sigma F1804 SREBP1-c Novus NB100-2215 Na/K+ ATPase CST 3010S Oligonucleotides and other sequence-based reagents Primer ID Sequence mMARCHF7 F. P M. musculus TCTTGGAGGCATAGTCAAGTTC mMARCHF7 R. P M. musculus GACTCTCTTCTCCTGTCCAAATC mHUWE1F.P M. musculus CACTGTCCTCCTCTCTCTATGT © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on January 7, 2025 from IP 2400:1a00:b030:5c8c:1ec:4998:fda6:5e7. ..

    Sequencing:

    Article Title: TRIM32 regulates insulin sensitivity by controlling insulin receptor degradation in the liver.
    Article Snippet: .. Reagents and tools table Reagent/Resource Reference or Source Identifier or Catalog Number Experimental models C57BL/6J (M. musculus) IISER Mohali, Chandigarh, India NA HepG2 ATCC HB-8065 293T ATCC CRL-11268 Recombinant DNA pEGFP-N1_hTRIM32 Addgene 69541 Reagent/Resource Reference or Source Identifier or Catalog Number HA-UBIQUITIN WT Addgene 17608 pcDNA3.1-2xFLAGSREBP-1c Addgene 26802 GFP-hIR Addgene 24049 pLKO.1 TRIM32 shRNA plasmid Merck TRCN0000040829 Antibodies pAKT S473 CST 4058S pAKT T308 CST 4056 tAKT CST 9272s pAMPKα CST 2535s tAMPKα CST 2535 pACC CST 3661 t-ACC CST 3676 GAPDH CST D16h11(5174) α-tubulin CST 2144 Phospho-IGF-I Receptor β (Tyr1135/1136)/ Insulin Receptor β (Tyr1150/1151) CST 3024 INSR CST 3020s GFP Novus NB600-308 FASn ABclonal A0461 TRIM32 ABclonal A7079 Lamin A/C CST 4777s Mouse-Anti-flag Sigma F1804 SREBP1-c Novus NB100-2215 Na/K+ ATPase CST 3010S Oligonucleotides and other sequence-based reagents Primer ID Sequence mMARCHF7 F. P M. musculus TCTTGGAGGCATAGTCAAGTTC mMARCHF7 R. P M. musculus GACTCTCTTCTCCTGTCCAAATC mHUWE1F.P M. musculus CACTGTCCTCCTCTCTCTATGT © The Author(s) EMBO reports 11 D ow nloaded from https://w w w .em bopress.org on January 7, 2025 from IP 2400:1a00:b030:5c8c:1ec:4998:fda6:5e7. ..



    Similar Products

    pampkα cst  (Cell Signaling Technology Inc)
    99
    Cell Signaling Technology Inc pampkα cst
    Pampkα Cst, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pampk%CE%B1+cst/Akt+Antibody/pm39747658-190-69-70
    Average 99 stars, based on 1 article reviews
    pampkα cst - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    rabbit pampkα thr172 cst 2535 wb  (Cell Signaling Technology Inc)
    98
    Cell Signaling Technology Inc rabbit pampkα thr172 cst 2535 wb
    Rabbit Pampkα Thr172 Cst 2535 Wb, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pampk%CE%B1+cst/Phospho-AMPKalpha+(Thr172)+Rabbit+mAb/pmc05828468__mmc1-880-20-10
    Average 98 stars, based on 1 article reviews
    rabbit pampkα thr172 cst 2535 wb - by Bioz Stars, 2026-09
    98/100 stars
    		  Buy from Supplier

    Image Search Results